protocols
Lab protocols for the Lowe-Power lab (scroll down for table of contents Readme)
PCRs to detect & classify plant pathogenic Ralstonia
Writing/editing credit: Caitilyn Allen lab, Tiffany Lowe-Power
1. Universal plant pathogenic Ralstonia PCR (759/760)
Detects a region present in most R. solanacearum, R. pseudosolanacearum, R. syzygii strains (82/85 tested by Opina)
Citation: Opina et al. 1997. A Novel Method For Development Of Species And Strain-Specific DNA Probes And PCR Primers For Identifying Burkholderia solanacearum (Formerly Pseudomonas solanacearum). Asia Pacific Journal of Molecular Biology and Biotechnology Volume 5, No. I, April, 1997 pp. l9-30.)
| Primer Name | Sequence (5’ to 3’) | |:———–:|:———————————| | 759 | GTC GCC GTC AAC TCA CTT TCC | | 760 | GTC GCC GTC AGC AAT GCG GAA TCG | Product Size: 281 bp
PCR conditions
- Controls:
- No template control
- Positive control (e.g. gDNA from GMI1000)
- Calculate OneTaq or similar mastermix with pcr_workbook
- Thermal cycler conditions: Run OneTaq program with 58C anneal & 30 s extension time
- Resolve on 2% agarose gel
2. Phylotype PCR (Multiplex)
Citation: Fegan, M, and P. Prior 2005. How complex is the R. solanacearum species complex? In: Bacterial Wilt: The Disease and the Ralstonia solanacearum species complex (C. Allen, P. Prior, and A.C. Hayward, editors). APS Press, St Paul.
| Common Primers (CP) Name | Primer Name | Sequence (5’ to 3’) | Phylo specificity | Band size (bp)* |
|---|---|---|---|---|
| CP1 | Nmult21:1F | CGTTGATGAGGCGCGCAATTT | I | 144 |
| CP2 | Nmult21:2F | AAGTTATGGACGGTGGAAGTC | II | 372 |
| CP3 | ßNmult23:AF | ATTACSAGAGCAATCGAAAGATT | III | 91 |
| CP4 | Nmult22:InF | ATTGCCAAGACGAGAGAAGTA | IV | 213 |
| CP5 | Nmult22:RR | TCGCTTGACCCTATAACGAGTA | all | N/A |
PCR conditions
- Controls:
- No template control
- Positive control (ideally 1 strain from each phylotype, but at a minimum do a gDNA from a known isolate)
-
XXX Someone needs to add this to pcr_workbook Reactions were carried out in a total volume of 20 µl containing 1 x PCR buffer (supplied by the manufacturer of the polymerase) 1.5 mM MgCl2, 0.2 mM of each dNTP, 2U of Taq Polymerase 6 pmoles of the primers Nmult:21:1F, Nmult:21:2F, Nmult:22:InF, 18 pmoles of the primer Nmult:23:AF and 4 pmoles of the primers 759 and 760 (1). Reactions were heated to 96oC for 5 min and then cycled through 30 cycles of 94oC for 15s, 59oC for 30s and 72oC for 30s, followed by a final extension period of 10 min at 72oC.
- Thermal cycler conditions: Run OneTaq program with 59C anneal & 30 s extension time
- Resolve on 2% agarose gel
Expected results:
3. Detection of Race 3 Biovar 2 strains
If reaction is positive, notify Tiffany Lowe-Power immediately. We are not permitted to receive, use, or store R3B2 organisms. If there is a positive reaction with the R3B2-specific primers, secure any materials with the R3B2 positive organism in a locked cabinet or freezer until they have been deactivated by autoclave. Tiffany will notify Aphis about the receipt of R3B2 organisms.
Citation: Opina et al. 1997. A Novel Method For Development Of Species And Strain-Specific DNA Probes And PCR Primers For Identifying Burkholderia solanacearum (Formerly Pseudomonas solanacearum). Asia Pacific Journal of Molecular Biology and Biotechnology Volume 5, No. I, April, 1997 pp. l9-30.)
| Primer Name | Sequence (5’ to 3’) | |:———–:|:———————————| | 630 | ATA CAG AAT TCG ACC GGC ACG | | 631 | ATT CAC ATG CAA TTC GCC TAC | Product Size: 307 bp
PCR conditions
- Controls:
- No template control
- Positive control (We do not have access to live Race 3 strains, but Caitilyn Allen’s lab generously purified DNA from UW551 for us)
- Calculate OneTaq or similar mastermix with pcr_workbook
- Thermal cycler conditions: Run OneTaq program with 60C anneal & 30 s extension time
- Resolve on 2% agarose gel
- If reaction is positive, notify Tiffany Lowe-Power immediately.
4. Multiplex PCR to Identify Ralstonia Species and Phylotype IIB1
Citation: “RSSC-Lineage Multiplex PCR” assay detects and differentiates Ralstonia solanacearum, R. pseudosolanacearum, R. syzygii and the R3bv2 subgroup, Sujan Paudel, 2022, https://doi.org/10.21203/rs.3.rs-1693987/v1
| Common Primers (CP) Name | Primer Name | Sequence (5’ to 3’) | Species Specificity | Band size (bp)* |
|---|---|---|---|---|
| CP6 | RssC-wF3 | TATATATCCTCGACTTTTCCATGAAGCTGTG | Ralstonia solanacearum species complex (F) | 162 |
| CP7 | RssCwR3 | CTATATATATACCCCACTTGTTGAGGAACTG | Ralstonia solanacearum species complex (R) | 162 |
| CP8 | Rpseu-wF5 | TTTTATTTTTTTGGTGTCCGGGCCAAGATAG | R. pseudosolanacearum (Phylotype I and III) (F) | 251 |
| CP9 | Rpseu-wR5 | TTATATTACTCGAACGTGCTGCAAAACCACT | R. pseudosolanacearum (Phylotype I and III) (R) | 251 |
| CP10 | RsolP2wF2 | ATTCTATTTATATCATGAGCGTTCCCCGACT | R. solanacearum (Phylotype II) (F) | 478 |
| CP11 | RsolP2wR2 | TTTTTTTTTTTGAGGTAGCTGCTGGGGTTC | R. solanacearum (Phylotype II) (R) | 478 |
| CP12 | RsyzP4wF4 | TTTCTTTTATTATAGTGTCGCGTCCGAACAG | R. syzygii (Phylotype IV) (F) | 664 |
| CP13 | RsyzP4wR4 | TTTTTCTTTTTCGGTCTCTCCGTCTATCGTT | R. syzygii (Phylotype IV) (R) | 664 |
| CP14 | RsR3B2wF | TTTCATTACTCATGACTGCAGAAACGCTTGA | Race 3 biovar 2 (II-R3bv2)(F) | 954 |
| CP15 | RsR3B2wR | TATACATAACTATAGTTCGCCGTGCTCATCT | Race 3 biovar 2 (II-R3bv2) (R) | 954 |
5. Determine Sequevar of an Isolate
This can be updated with more specific details
The sequevar system is a DNA based taxonomic system of plant pathogenic Ralstonia. The system is based on DNA sequence alignments of a 750 bp region of the egl endoglucanase gene.
Step 1: Purify genomic DNA from the isolate
- Streak out the isolate on CPG+TZC and obtain single colonies.
- Inoculate a single colony into CPG broth and incubate overnight.
- Extract DNA from 1 ml of a dense culture using the DNeasy Blood & Tissue kit.
Step 2: Amplify a 750 bp region of the egl gene
| Primer Name | Sequence (5’ to 3’) |
|---|---|
| Endo-F | ATGCATGCCGCTGGTCGCCGC |
| Endo-R | GCGTTGCCCGGCACGAACACC |
Follow instructions for a High Fidelity PCR reaction (E.g. Kapa HiFi) to amplify the band. You will add 50 ng of purified genomic DNA as template. Run a program that is appropriate for a 750 bp target. Use an anneal temperature of 60 C (it looks like anything from 55-64C has been used in the literature).
Step 3: Visualize on an agarose gel to confirm a successful amplification
See the DNA electrophoresis protocol for more details.
- Make a 0.8% w/v agarose gel in 1x LAB buffer with ethidium bromide.
- Load 2 ul of your PCR reaction (mix with loading buffer). Don’t forget to run DNA ladder in a well.
- Run the gel
- Visualize the gel on a UV box. Save a photograph.
- Analyze the gel – annotate a few size markers on the ladder. You should have 1 strong, single band at 750 bp in your PCR wells.
Troubleshoot the PCR if necessary, otherwise proceed to step 4
Step 4: Purify the PCR reaction
Use the Zymo DNA clean & concentrator kit to purify your PCR products (1 prep per reaction).
Check DNA purity on the nanodrop. Record the estimated DNA concentration and 260/280 and 260/230 ratios. Also save a photograph of the full spectra of you DNA. Discuss with someone whether it looks “pure” or whether there are contaminant peaks.
Step 5: Submit the sample for Sanger Sequencing
Follow the Sanger Sequencing protocol. Sequence the reactions with both the Endo-F and Endo-R primers (separate reactions)
Step 6: Interpret the sequence.
Import the sequencing trace (.ab1 file) into Benchling in the “1-egl (partial) sequences”. Align the F and R and proofread the sequences.
After this point … Tiffany has a word protocol from Caitilyn’s lab that we can adapt to assign a sequevar based on the sequence.